Bay 11-7085

Toll-like receptors participate in Naegleria fowleri recognition

Moisés Martínez-Castillo • Leopoldo Santos-Argumedo • José Manuel Galván-Moroyoqui • Jesús Serrano-Luna • Mineko Shibayama
1 Department of Infectomics and Molecular Pathogenesis, Center for Research and Advanced Studies of the National Polytechnic Institute, Av. IPN 2508, 07360 Mexico City, Mexico
2 Department of Molecular Biomedicine, Center for Research and Advanced Studies of the National Polytechnic Institute, Av. IPN 2508, 07360 Mexico City, Mexico
3 Department of Medicine and Health Sciences, University of Sonora, Boulevard Luis Donaldo Colosio and Francisco Q. Salazar S/N, 83000 Hermosillo, SON, Mexico
4 Department of Cell Biology, Center for Research and Advanced Studies of the National Polytechnic Institute, Av. IPN 2508, 07360 Mexico City, Mexico

Abstract
Naegleria fowleri is a protozoan that invades the central nervous system and causes primary amoebic meningo- encephalitis. It has been reported that N. fowleri induces an important inflammatory response during the infection. In the present study, we evaluated the roles of Toll-like receptors in the recognition of N. fowleri trophozoites by human mucoepithelial cells, analyzing the expression and production of innate immune response mediators. After amoebic interac- tions with NCI-H292 cells, the expression and production levels of IL-8, TNF-α, IL-1β, and human beta defensin-2 were evaluated by RT-PCR, ELISA, immunofluorescence, and dot blot assays, respectively. To determine whether the canonical signaling pathways were engaged, we used different inhibitors, namely, IMG-2005 for MyD88 and BAY 11-7085 for the nu- clear factor NFkB. Our results showed that the expression and production of the pro-inflammatory cytokines and beta defensin-2 were induced by N. fowleri mainly through the canonical TLR4 pathway in a time-dependent manner.

Introduction
Primary amoebic meningoencephalitis (PAM) is caused by the protozoan Naegleria fowleri. This infection is highly relevant to the medical community because the evolution of the illness is acute and usually fatal. Experimental PAM has provided important information regarding the invasive process of the amoeba and the molecular interactions between the amoeba and the host.
Immunohistochemical studies of the early events of infec- tion using the murine model have shown that the amoebae induce intense mucus secretion and an inflammatory reaction in the nasal cavity (Cervantes-Sandoval et al. 2008b; Rojas- Hernandez et al. 2004). However, N. fowleri is able to evade the innate immune responses of the host (Cervantes-Sandoval et al. 2008a), enabling the trophozoites to adhere to the neuro- olfactory epithelium. Recently, our group demonstrated in vitro that the production of mucin (MUC5AC) and expression of pro-inflammatory cytokines were activated by ROS and EGFR (Cervantes-Sandoval et al. 2009). However, it is known that other cellular receptors, such as Toll-like receptors (TLRs), are involved in the recognition of several pathogens and their products (damage-associated molecular patterns, DAMPs).
TLRs are expressed by several immune cell types, includ- ing macrophages, natural killer lymphocytes, and dendritic cells. Endothelial and mucoepithelial cells also express these types of receptors (Becker et al. 2000; Cario et al. 2000; Faure et al. 2001; Muzio et al. 2000; Visintin et al. 2001). Intracellular signaling by TLRs is coordinated by adapter mol- ecules such as MyD88, MAL, and TRIF (O’Neill and Bowie 2007). The adapter molecules are capable of activating ki- nases (IRAK1 and IKK4) (Arbibe et al. 2000). The activation of kinases induces the dissociation of the NFkB inhibitor com- plex, leading to translocation of NFkB, which induces the expression of pro-inflammatory cytokines (Barton and Medzhitov 2003; Galván-Moroyoqui et al. 2011), mucins (Jono et al. 2002; McGuinness et al. 2003), and antimicrobial peptides (Froy 2005; Rivas-Santiago et al. 2006).
Activation of TLRs has been extensively studied using spe- cific pathogen-associated molecular patterns (PAMPs) that are present in bacteria (e.g., Lipopolysaccharide, LPS and Peptidoglycan, PGN), fungi (Zymosan), and synthetic molecules (Pam3CysSK4) (Akira and Takeda 2004; Palsson- McDermott and O’Neill 2007; Poltorak et al. 1998). However, in the case of protozoan parasites, only a few PAMP molecules have been identified. For example, in Entamoeba histolytica, lipopeptidophosphoglycan (LPPG) and lectin Gal/GalNAc (Gal-lectin) are able to activate TLR2 and TLR4 (Maldonado- Bernal et al. 2005; Moncada et al. 2003).
Regarding N. fowleri trophozoites, there are no studies as- sociated with the type of receptors involved in the recognition of proteins (PAMPs) or secreted molecules (DAMPs) by N. fowleri. In the present study, we show the activation of TLR2 and TLR4 by N. fowleri trophozoites in a mucoepithelial cell line. Moreover, the inflammatory response by NCI-H292 cells that includes IL-8, Tumor necrosis factor alpha (TNF-α), IL-1β, and human beta defensin-2 (HBD2) production sug- gests that N. fowleri is mainly recognized by TLR4.

Materials and methods
Amoebic and cell cultures
A pathogenic strain of N. fowleri (ATCC 30808) was used in all experiments. Trophozoites were axenically cultured in 2% (w/v) Bacto Casitone medium supplemented with 10% (v/v) fetal bovine serum (FBS; Equitech-bio) at 37 °C. Trophozoites were harvested during the logarithmic phase of growth (48 h).
Mucoepithelial cells (NCI-H292; ATCC: CRL1848) were grown in RPMI 1640 (Gibco, Invitrogen, USA) with 10% (v/ v) FBS (Equitech-bio, USA) in a 5% CO2 atmosphere at 37 °C. The cells were grown to 80% confluence, subsequently serum-starved for 24 h and finally incubated with specific inhibitors in the presence or absence of LPS (TLR4) and PGN (TLR2), together with N. fowleri trophozoites.

Viability and purity analysis of cell cultures
NCI-H292 cells (5 × 104) or N. fowleri trophozoites (5 × 104) were seeded in 24-well culture dishes (Costar, Corning, USA) and incubated with an inhibitor of either TLR2 or TLR4. Viability was analyzed at 1, 3, 6, 12, and 24 h by trypan blue dye exclusion (data not shown). Furthermore, both the NCI- H292 cells and N. fowleri trophozoites were exposed to a fluorescent compound, Sytox green (1:500; Molecular Probes, USA), to verify that the cells were not contaminated with bacteria or other microorganisms (data not shown). This assay also allowed evaluations of cell viability.

Expression of TLR2 and TLR4 in the NCI-H292 cell line
Expression of the TLRs in the human mucoepithelial cell line was analyzed by RT-PCR, FACS, and Western blotting (WB). For RT-PCR, total RNA was isolated using the QIAamp RNA blood mini kit (Qiagen, USA), according to the manufac- turer’s procedure. The primers used were as follows: for gapdh, forward 5′-CCACCCATGGCAAATTCCATGGCA- 3′, reverse 5′-TCTAGACGGCAGGTCAGGTCCACC-3′; for tlr2, forward 5′-GCCAAAGTCTTGATTGATTGG-3′, re- verse 5-´TTGAAGTTCTCCAGCTCCTG-3′; and for tlr4, forward 5′-TACAGAAGCTGGTGGCTGTG-3′, reverse 5′- CCAGAACCAAACGATGGACT 3′. These primers were previously reported in other upper airway epithelial cell line (BEAS-2B) (Schmeck et al. 2006). PCR products were ana- lyzed by electrophoresis in 2% (w/v) agarose gels, which were stained with ethidium bromide and visualized on a UV trans- illuminator (Bio-Rad, USA).
For FACS analysis, cellular suspensions were incubated with the monoclonal antibody (mAb) anti-CD282-TLR2 (IMG-319, IMGENEX, USA) or with mAb anti-CD284-TLR4 (IMGENEX; according to the manufacturer’s recom- mendation) (1:50); mouse IgG was used as the isotype control. Samples were then incubated with a secondary antibody, goat anti-mouse-FITC, for the FACS analysis (IMG-20102, IMGENEX, USA) (1:100). The FACS analysis was performed with a FACSCalibur flow cytometer (BD, Biosciences, USA), and the data were processed using the FlowJo software pack- age (Tree Star, Inc., Ashland, OR, USA). In addition, samples were analyzed under a confocal microscope (Leica, LSM700). For the WB assays, the same primary antibodies were used at 1:1000, and the goat-anti-mouse-IgG peroxidase-conjugated secondary antibodies were used at 1:2500 (Invitrogen, USA). Finally, the membranes were visualized using the luminol kit reagent (Santa Cruz Biotechnology, USA) and photographic Kodak film (Kodak, USA).

Interactions of N. fowleri trophozoites with NCI-H292 cells
To determine the immune response by the mucoepithelial cells via TLRs, NCI-H292 cells were co-incubated with N. fowleri trophozoites at a ratio of 1:1 in the presence or absence of the different inhibitors. The inhibitors used for the TLRs included 1-palmitoyl-2-arachidonyl-snglycero-3-phosphorylcholine (OXPAPC, 30 μg/ml; InVivoGen, USA) or mAb anti-CD282-TLR2 (10 μg/ml; Clone TL2.1; IMGENEX, USA) for TLR2 inhibition, CLI-095 (3 μM; InVivoGen, USA) for TLR4 inhi- bition, IMG-2005 (100 μM; IMGENEX, USA) for MyD88 inhibition, and BAY 11-7085 (2 μM; Sigma-Aldrich, USA) for NFkB inhibition. The NCI-H292 interaction with the amoeba was performed at 1, 3, and 6 h. After 6 h, the tropho- zoites were removed by chilling for 25 min, and the incuba- tion was continued thereafter for 12 and 24 h. This procedure was necessary to avoid damage to the cell monolayer. Co- cultures were performed at 37 °C in a 5% CO2 atmosphere. As positive controls, cells were stimulated with PGN from Bacillus subtilis (10 μM; InVivoGen, USA) and LPS from Escherichia coli 026:B6 (40 μg/ml; Sigma-Aldrich, USA) at the same times studied (data not shown). For negative con- trols, cells were incubated in RPMI medium without serum for 24 h to maintain basal levels of cytokines and HBD2. Finally, the cell-culture supernatants and cell lysates were collected for further experiments.

Cytokine mRNA expression by RT-PCR
For analysis of il-8, tnf-α, il-1β, and gapdh gene expression, total RNA was isolated from NCI-H292 cells (5 × 106) alone or from those that were co-incubated with N. fowleri tropho- zoites during 1, 3, 6, 12, and 24 h. For the semi-quantitative PCR, the total RNA was obtained using the Trizol Reagent® (Invitrogen, USA), and the reverse transcribed was performed using the First Strand Complementary DNA (cDNA) Synthesis Kit (Fermentas, Thermo Scientific, USA), accord- ing to the manufacturer’s procedure. Briefly, total RNA was quantified with nanodrop spectrophotometer (Eppendorf, USA). To confirm that we use equal amounts of RNA in each experiment, all the samples were checked with gapdh mRNA expression. Five micrograms of total RNA was added to the mix cDNA synthesis that contained an oligo (dT18) primer, 5× reaction buffer, 20 U/μl RibolockTM RNase, 10 mM dNTP mix, and 20 U/μl M-MulV Reverse Transcriptase). Mix reaction was adjusted at 20 μl with free-RNAse water. For PCR assay, 0.5 μg of cDNAwas used as template, togeth- er with 10 mM dNTP mix, 50 mM MgCl, and 10 mM of each specific primer (il-8, tnf-α, il-1β, and gapdh) that have been previously reported (Cervantes-Sandoval et al. 2009), and 2.5 U of Taq DNA polymerase (Invitrogen, USA). PCR was carried out for 35 cycles comprising 30 s at 94 °C, 30 s at 55 °C, and 30 s at 68 °C. Then, PCR products were analyzed by electrophoresis in 2% agarose gels, stained with ethidium bromide and visualized on a UV transilluminator (Bio-Rad, USA). As experimental controls, we also performed RT-PCR from NCI-H292 cells co-incubated with LPS or PGN at the same times mentioned before (data not shown). The optical densities of the PCR products of each cytokine assayed were analyzed using the NIH image processing software, ImageJ (http://rsb.info.nih.gov/nih-image); the results were normalized with the optical density of the internal control, gapdh, and expressed as a relative optical density (ROD).

Production of IL-8, TNF-α, and IL-1β
Production of pro-inflammatory cytokines, namely, IL-8, TNF-α, and IL-1β, from NCI-H292 cells was assessed by ELISA after amoebic co-incubations. Supernatants from each interaction time (1, 3, 6, 12, and 24 h) were recovered, and production of the different cytokines was quantified using the Human IL-8 ELISA Kit II, Human TNF-α ELISA Kit II, and Human IL-1β ELISA Kit II (BD OptEIA™, USA), according to the manufacturer’s instructions. To determinate the protein levels, the absorbance data were adjusted according to the values of the standard curves included in the corresponding kits (BD OptEIA™, USA). The data were analyzed with Sigma Plot 12 (http://www.sigmaplot.com) software, and the graphics were obtained with GraphPad Prism 5 software.

Detection of antimicrobial peptides
Production of antimicrobial peptides by the mucoepithelial cells was evaluated using immunofluorescence and dot blot assays. NCI-H292 cells were co-incubated with N. fowleri at 1, 3, 6, 12, and 24 h. The samples were washed with PBS and permeabilized with 0.2% Triton X-100 for 15 min. Non- specific sites was blocked with 1% bovine serum albumin for 1 h at 37 °C. Then, the samples were incubated with a polyclonal antibody, goat-anti-HBD2 (Santa Cruz, Biotechnology, USA), diluted to 1:50 in PBS, for 2 h at 37 °C and afterward with a rhodamine-conjugated horse- anti-goat antibody diluted to 1:50 for 1 h at room temperature (Abcam, USA). Nuclei were stained with 15 nM Sytox green for 10 min (Molecular Probes, USA). LPS and PGN were used as positive stimuli for HBD2, whereas serum-free RPMI medium was used as the negative control. The cells were washed and mounted in Vectashield (Vector Laboratory, USA). Finally, the cells were examined with a confocal microscope (Leica, LSM700).
Dot blot analysis of HBD2 was performed. Briefly, the su- pernatants of NCI-H292 that were incubated with N. fowleri for the same time periods were recovered, and the total protein concentration was measured using the Bradford method and quantified spectrophotometrically (Epoch; BioTek, Take3™, USA). Five micrograms of protein were absorbed onto a nitro- cellulose membrane (Pierce, USA) and blocked with 5% (w/v) skim milk for 1 h. Then, the membranes were washed four times with 0.05% PBS-Tween (PBS-T; v/v) and incubated with a polyclonal antibody, goat-anti-HBD2 (1:200), for 2 h at 37 °C. The membranes were washed with PBS-T (four times) and incubated with HRP-conjugated mouse-anti-goat second- ary antibody diluted to 1:1500 for 1 h at room temperature. Thereafter, the membranes were washed six times with PBS-T and developed with a luminol kit reagent (Santa Cruz Biotechnology, USA). The LPS and PGN stimuli and basal production were also evaluated. The optical densities of the dot blots were analyzed using ImageJ software.

Statistical analysis
Statistical analysis of NCI-H292 cytokine production and of the inhibitory effect of the inhibitors of each TLR was per- formed using two-way ANOVA and Bonferroni’s post hoc test, which allowed a multiple comparison of at least two groups with different experimental conditions. Data are pre- sented as the mean ± SD and compared with the cytokine production by N. fowleri without an inhibitor for each condi- tion. The densitometric analysis was performed using Sigma Plot 12 software, and the graphics were obtained with GraphPad Prism 5 software.

Results
Detection of TLR2 and TLR4 in mucoepithelial cells
To verify the expression of the TLRs in the mucoepithelial cell line NCI-H292, we evaluated the expression of tlr2 (347 bp) and tlr4 (399 bp) by RT-PCR (Fig. 1a). We observed that the cell line expressed both TLRs under basal conditions. To con- firm protein expression, we performed and analyzed WBs, and as expected, we detected 88 and 94 kDa bands that corresponded to TLR2 and TLR4, respectively (Fig. 1b). Moreover, both TLRs were immunolocalized to the cell mem- branes of the NCI-H292 cells (Fig. 1b). To quantify both TLRs in the NCI-H292 cell line, we performed FACS analy- ses. Our results showed that the mean fluorescence intensity (MFI) for TLR2 was 22.97, while the MFI for TLR4 was 18.99; the isotype control did not display significant MFI values (Fig. 1c). Taken together, these results indicated that under basal conditions, NCI-H292 expressed both TLR types.

Viability assays
After determining the expression and production of TLR2 and TLR4 by the mucoepithelial cells, viability was assessed after cells were incubated with the corresponding inhibitors. The viability was evaluated using trypan blue dye exclusion (data not shown) and Sytox green assays (Fig. 2a). After incuba- tions with the TLR2 inhibitors (OXPAPC and mAb-TLR2), TLR4 inhibitor (CLI-095), MyD88 inhibitor (IMG-2005), and NFkB inhibitor (BAY 11-7085), we observed 95% viability in all the conditions tested. Similar assays were performed to analyze the effects of these inhibitors on the N. fowleri tropho- zoites; the viability was near 97% (Fig. 2b).

N. fowleri induces cytokine expression through TLR2 and TLR4
To determine the role of the TLRs in N. fowleri recognition, NCI-H292 cells were co-incubated for different times after interactions with the trophozoites. Gene expression of pro- inflammatory cytokines was determined in the presence or absence of either the TLR2 or the TLR4 inhibitor. The results showed that N. fowleri was able to induce the expression of il- 8, tnf-α, and il-β in a time-dependent manner without the inhibitors (Fig. 3a, c, e). In contrast, the expression of these cytokines diminished significantly in the presence of CLI-095 (inhibitor of TLR4) and subsequently with OXPAPC and mAb-TLR2 (inhibitors of TLR2) (Fig. 3a, c, e). The inhibition of cytokine expression was evident at all evaluated time points. However, expression was partially recovered at 24 h (Fig. 3a, c, e). Relative optical density (ROD) values were analyzed using the NIH image processing software, ImageJ (http://rsb.info.nih.gov/nih-image), and the graphic with normalization to the housekeeping gapdh gene (Fig. 3g) was obtained with GraphPad Prism (Fig. 3b, d, f).

Recognition of N. fowleri through TLR2 and TLR4 induces cytokine production in mucoepithelial cells
To evaluate whether N. fowleri trophozoites induce the pro- duction of pro-inflammatory cytokines by the mucoepithelial cells via the TLRs, supernatants from the interactions between the amoebae and NCI-H292 cells were collected, and IL-8, TNF-α, and IL-1β were measured by ELISA. The level of cytokine production was quantified without the amoeba and compared with the production induced by the N. fowleri tro- phozoites without the TLR2 and TLR4 inhibitors (Fig. 4a–c). The amoeba induced the production of IL-8 in a time- dependent manner (1, 3, 6, 12, and 24 h); maximal production of IL-8 at 185.7 ± 11.55 pg/ml occurred at 24 h (*p < 0.05) (Fig. 4a). Furthermore, the production of IL-8 was significant- ly inhibited in the presence of CLI-095 (107.6 ± 0.46 pg/ml) (43% inhibition) compared with IL-8 production in the pres- ence of mAb-TLR2 (162.6 ± 3.25 pg/ml) (12.5%) at 24 h and the OXPAPC inhibitor (111.9 ± 4.71 pg/ml) (39.7%) (Fig. 4a) (*p < 0.05 and **p < 0.001). Tumor necrosis factor alpha (TNF-α) is a pro- inflammatory cytokine that is involved in cell recruitment during infections by microorganism. Our results showed that N. fowleri induced TNF-α production in the NCI-H292 cells. Maximal production by N. fowleri was 244.4 ± 12.72 pg/ml at 6 h of co-incubation (*p < 0.05). Moreover, TNF-α produc- tion decreased significantly with CLI-095 (45.96 ± 0.93 pg/ ml) (82%), while mAb-TLR2 and OXPAPC inhibitors dimin- ished TNF-α production to 45.81 ± 3.59 pg/ml (81%) and 66.83 ± 5.02 pg/ml (72%), respectively; the production was compared without inhibitors at the same interaction time points (Fig. 4b; **p < 0.001). The effects of the inhibitors showed a higher inhibition of TNF-α than IL-8 production. Statistical analysis was performed similar to the analysis de- scribed for IL-8 (Fig. 4b) (**p < 0.001). Interleukin 1 beta (IL-1β) is a potent mediator of the re- sponse to infection and tissue injury. When the production of this cytokine was measured, a significant rise was observed after N. fowleri interaction. However, the IL-1β amount was lower compared with the other cytokines studied. The maxi- mal production by N. fowleri was 43.98 ± 0.40 pg/ml at 24 h (Fig. 4c; *p < 0.05). However, treatment with CLI-095 showed a higher inhibition of the production of IL-1β (12.63 ± 0.94 pg/ml) (71%) compared with the treatments with the TLR2 inhibitors, while the mAb-TLR2 and OXPAPC inhibitors diminished IL-1β at 28.48 ± 1.35 pg/ml (35%) and 36.94 ± 3.78 pg/ml (16%), respectively, at 24 h (Fig. 4c; *p < 0.001). Statistical analysis was performed as described above. Cells that were incubated with each inhibitor did not show inductions of the pro-inflammatory cytokines at any time point (data not shown). Although the inhibitory ef- fect of the antagonist was evident after 1, 3, and 6 h in all cytokine assays, it was partially lost after 12 and 24 h. Our results show that TLR4 participates mainly in IL-8, TNF-α, and IL-1β cytokine production; nevertheless, TLR2 partici- pates to a lesser degree. The canonical TLR pathway is involved in the recognition of N. fowleri trophozoites To evaluate whether the canonical signaling pathway partici- pates in the production of pro-inflammatory cytokines by the amoeba, mucoepithelial cells were incubated with the MyD88 and NFkB inhibitors. NCI-H292 cells were preincubated with IMG-2005 and BAY 11-7085 for 2 h. The results showed a significant inhibition of all cytokines evaluated when the TLRs were partially blocked upstream with the MyD88 inhibitor (IMG-2005) and downstream with the NFkB inhib- itor (BAY 11-7085) at 1, 3, 6, 12, and 24 h post-incubation. Maximal TNF-α (287.33 ± 18.45 pg/ml) production occurred at 6 h and was similar to the previously indicated level, while maximal production of IL-8 (189.87 ± 21.27 pg/ml) and IL- 1β (56.98 ± 6.11 pg/ml) was reached at 24 h (Fig. 5a–c, gray bars). Nevertheless, IMG-2005 diminished IL-8 by 43%, TNF-α by 75%, and IL-1β by 41%. Moreover, a higher inhi- bition was observed with BAY 11-7085: 73% for IL-8, 80% for TNF-α, and 49% for IL-1β. All assays were compared without inhibitors. N. fowleri induces human β2 defensin production through TLR2 and TLR4 Antimicrobial peptides participate in non-specific defenses against microbes on mucosal surfaces. To analyze the production of HBD2 via TLR2 and TLR4, we used CLI-095 and mAb-TLR2 (we chose the antibody because it showed a specific inhibitory effect). Confocal microscopy results showed the ability of N. fowleri trophozoites to induce HBD2 by NCI-H292 cells, and HBD2 appeared at 6 h post- incubation with a maximal production at 12 h compared with the basal condition at the same time point (12 h) (Fig. 6a). Human defensin was mainly inhibited by CLI-095 (the TLR4 inhibitor) (Fig. 6a). LPS and PGN were used as positive con- trols in the presence or absence of the inhibitors (Fig. 6b). The MFI was evaluated for each experimental condition using the NIH image processing software, ImageJ (http://rsb.info.nih. gov/nih-image) (Fig. 6c). In addition, dot blot assays allowed us to evaluate HB2D secretion by NCI-H292 in the presence of N. fowleri trophozoites with maximal secretion at 12 h post- interaction with the amoebae (Fig. 7a). CLI-095 showed an evident inhibitory effect compared with mAb-TLR2 (Fig. 7a, c); these results correlated with the confocal findings. LPS and PGN were used as positive controls for the dot blot analyses. The dots were analyzed using the NIH image processing soft- ware Image J ( http://rsb.info.nih.gov/nih-image). Densitometric analysis was performed using GraphPad Prism. Discussion The infection by the protozoan N. fowleri produces PAM, a severe and fulminant disease in the CNS. Unfortunately, this acute infection leads to death approximately 1 week after the onset of symptoms (Valenzuela et al. 1984; Yoder et al. 2012). Autopsies of PAM have revealed brain inflammation with severe tissue damage throughout the area of invasion, with ulceration of the olfactory mucosa and necrosis of the olfactory nerves (Sugita et al. 1999; Visvesvara 2013). Moreover, studies based on a mouse model showed that trophozoites invade the olfactory mucosa and eventually reach the olfactory bulbs, causing the death of the animal at 7 days after exposure to the amoebae. In the early stages of infection, N. fowleri trophozoites are embedded in a mu- cosal layer with an important number of polymorphonuclear cells (Rojas-Hernandez et al. 2004). In this region, mucosal secretions, local inflammation, lactoferrin, lysozyme, and defensins, among other molecules, form a protective barrier against microbial infections. However, N. fowleri is capable of evading these innate immune responses and eventually produce the PAM disease. Several in vitro studies have been carried out to analyze the production of inflammatory cyto- kines stimulated by N. fowleri in mucoepithelial and microglial cells (Kim et al. 2012b; Lee et al. 2011; Oh et al. 2005). However, the role of cellular receptors that are associated with the recognition of N. fowleri trophozo- ites and production of pro-inflammatory cytokines is still unknown. During microbial infections and tissue injury, TLRs play pivotal roles in the induction of pro-inflammatory cytokines that can modulate the progression of the infection (Lehnardt 2010). For example, it has been reported in toxoplasmosis and sleeping sickness that host responses mediated through TLRs contribute to parasite clearance and host survival (Mishra et al. 2009). However, TLR-mediated responses can also have an important contribution to the development of cerebral malaria, neurocysticercosis, and river blindness (de Veer et al. 2003; Loharungsikul et al. 2008). In the pres- ent study, we analyzed the role of TLRs in the recognition of N. fowleri by NCI-H292. To evaluate TLRs participation in the recognition of N. fowleri trophozoites, we evaluated the upstream and downstream signaling pathways of TLR2 and TLR4 using specific inhibitors. Here, we used different methodologies to demonstrate the presence of TLRs in NCI-H292 cells; our results showed that TLR2 expression was similar to that of TLR4 under basal conditions. However, it has been reported that TLR4 expression is in- ducible in NCI-H292 cells in response to LPS stimuli (Shaykhiev et al. 2010). Furthermore, in Acanthamoeba spp., it was reported that the trophozoites induce TLR2 and TLR4 expressions in ependymocytes, neurons, glial, and endothelial cells from the brain of BALB/c mice, the authors suggested that the expression of these receptors were regulated by pathogen-associated molecular patterns (PAMPs) in this amoeba (Wojtkowiak-Giera et al. 2016). Thus, we are interested in evaluating if these TLRs increase in the presence of N. fowleri and its proteins (total extracts and/or secretory products). In our study, it was demonstrated that N. fowleri was capa- ble of inducing the expression and secretion of IL-8, TNF-α, and IL-1β by human mucoepithelial cells via TLR activation. The production of cytokines began during the first hour after the interactions and increased strongly at 12 and 24 h com- pared with the controls. The results of the cytokine expression by N. fowleri trophozoites were consistent with a previous report by our group using NCI-H292 cells (Cervantes- Sandoval et al. 2009). On the other hand, quantifications of cytokine production by ELISA showed correlations with the gene expression of each pro-inflammatory cytokine evaluated. Moreover, the production of pro-inflammatory cytokines in- duced by N. fowleri occurred mainly through TLR4 because the specific inhibitor CLI-095 showed higher inhibition than the mAb-TLR2 antibody and OXPAPC (TLR2 inhibitor). It is important to mention that the inhibitory effect of OXPAPC against TLR2 and TLR4 has been reported, and the authors showed that TNF-α production diminished in the blood sam- ples from infected mice with Vibrio vulnificus via TLR2 and TLR4 with the OXPAPC treatment (Erridge et al. 2008; Stamm and Drapp 2014); these behaviors were partially ob- served in our results, especially for IL-8 and TNF-α, where OXPAPC strongly decreased cytokine production compared to monoclonal antibody. However, this phenomenon could have been owing to dual inhibition of TLR2 and TLR4; thus, we consider that the antibody against TLR2 showed specific inhibition compared to OXPAPC. Moreover, the inhibitory effects of all inhibitors were more evident from 1 to 6 h. However, the production of cytokines was partially recovery at 12 and 24 h; this partial inhibition was previously reported in monocyte cells that were incubated with Listeria monocytogenes (Flo et al. 2000). It is possible that the inhibi- tion may have been diminished by the half-life of each inhib- itor used in the present study. This observation was mainly with TLR4, which correlates with a study using human cor- neal epithelial cells that were incubated with Acanthamoeba (T4 genotype); the authors concluded that the production of IL-8 and TNF-α were mediated by TLR4, while TLR2 had a minimal role in the production of these cytokines (Ren et al. 2010; Ren and Wu 2011). Moreover, the authors reported that the classical pathway of MyD88 and NFkB participates in pro-inflammatory cytokine production (Ren et al. 2010). Here, the upstream and downstream signaling pathways of TLR2 and TLR4 were evaluated by blocking the MyD88 protein, which is the first adaptor molecule involved in TLR signaling, and transcription factor NFkB (Akira and Takeda 2004). We found that both the MyD88 and NFkB proteins were important during the recognition of N. fowleri trophozo- ites because the IMG-2005 and BAY 11-7085 inhibitors caused a significant reduction in IL-8, TNF-α, and IL-1β productions. Interestingly, we found that mainly TNF-α pro- duction was mediated via TLRs because the inhibition was more evident with the specific inhibitors than the inhibition of IL-8 and IL-1β cytokines. These results support the partic- ipation of different cell pathways in producing pro- inflammatory cytokines (e.g., EGFR) (Cervantes-Sandoval et al. 2009).
Other studies have shown that MyD88 participates in the control of sleeping sickness produced by Trypanosoma brucei (Drennan et al. 2005); MyD88 has a crucial role in the clear- ance of toxoplasmosis (Mishra et al. 2009). However, in ma- laria, a dual role for MyD88 has been reported because the presence of MyD88 is important in the erythrocyte cycle of the infection, though the same effector molecule does not par- ticipate in the later stages of the disease (Mishra et al. 2009). These results suggest that TLRs are involved in the contain- ment (toxoplasmosis and sleeping sickness) or exacerbation of disease (cerebral malaria), depending on the period of the in- fection and the tissue invaded by these pathogens (Coban et al. 2007; Cox 2002; Mockenhaupt et al. 2006). We are interested in evaluating MyD88 in a knockout mouse to evaluate the specific in vivo role of this molecule during experimental PAM. On the other hand, total cytokine inhibition was not observed in the present study. Thus, we cannot discard other molecular receptors or additional pathways that could be in- volved in cytokine production, such as the protease-activated receptor, TNF-α receptor, NLRP3 inflammasome activation, EGFR, and MAP kinases (Cervantes-Sandoval et al. 2009; Coughlin 2000; Cuenda and Rousseau 2007; Kim et al. 2016; Sedger and McDermott 2014).
Other important molecules that can participate in the innate immune response during the acute stage of microbial infections and that are mediated via TLRs are the antimicrobial peptides such as defensins. Our results showed that the cationic peptide HBD2 was produced through the classical pathway of TLRs. The analyses by confocal microscopy and dot blots showed that HBD2 had a maximum detection at 12 h post-incubation. Interestingly, TRL4 displayed a higher recognition of N. fowleri trophozoites than TLR2. Moreover, N. fowleri in- duced a higher HBD2 production than the non-pathogenic N. gruberi (data not shown). Currently, we are working with the HBD2 and human neutrophil peptide (HNP2) and their possible effects on N. fowleri trophozoites. In the present study, we can observe that human mucoepithelial cells recognize N. fowleri through TLRs, mainly TLR4, and this recognition could be due to a specific PAMPs and/or DAMPs present in the amoeba, such as proteases, glycoconjugates, or lectins, among others (Fig. 8) (Cervantes-Sandoval et al. 2010; Han et al. 2004; Kim et al. 2013; Serrano-Luna et al. 2013). These PAMPs and DAMPs have been reported in other pathogenic microorganisms, for example in, E. histolytica, Acanthamoeba spp. and bacterial proteases (Abhyankar et al. 2017; de Zoete et al. 2011; Derda et al. 2016; Kim et al. 2012a; Maldonado- Bernal et al. 2005). It is important to mention that during the first hours of N. fowleri infection, a transitory acute inflamma- tory reaction was observed (Cervantes-Sandoval et al. 2008b; Rojas-Hernandez et al. 2004). This inflammation could be me- diated by the recognition of the specific PAMPs and/or DAMPs that consequently stimulate the production of immune mediators (cytokines and defensins) and the recruitment of inflammatory cells to the nasal epithelium.
In summary, our findings provide important evidence that TLRs could participate in the recognition of N. fowleri tropho- zoites and contribute to the understanding of the host-parasite interaction during infection. Knowledge of TLRs and protozoan-derived molecules that can elicit pro-inflammatory versus regulatory/antiinflammatory responses will be crucial toward designing novel therapeutic strategies against N. fowleri.